From 9155bb3345aaf481939e4e0d18b3eeebc27ea159 Mon Sep 17 00:00:00 2001 From: Rob Pike Date: Mon, 3 Aug 2009 21:03:58 -0700 Subject: [PATCH] benchmark checkpoint milestone checkin submission R=rsc DELTA=311 (311 added, 0 deleted, 0 changed) OCL=32696 CL=32699 --- test/bench/fasta.c | 173 ++++++++++++++++++++++++++++++++++++++ test/bench/fasta.go | 198 ++++++++++++++++++++++++++++++++++++++++++++ 2 files changed, 371 insertions(+) create mode 100644 test/bench/fasta.c create mode 100644 test/bench/fasta.go diff --git a/test/bench/fasta.c b/test/bench/fasta.c new file mode 100644 index 0000000000..9cd7f25c2f --- /dev/null +++ b/test/bench/fasta.c @@ -0,0 +1,173 @@ +/* +Redistribution and use in source and binary forms, with or without +modification, are permitted provided that the following conditions are met: + + * Redistributions of source code must retain the above copyright + notice, this list of conditions and the following disclaimer. + + * Redistributions in binary form must reproduce the above copyright + notice, this list of conditions and the following disclaimer in the + documentation and/or other materials provided with the distribution. + + * Neither the name of "The Computer Language Benchmarks Game" nor the + name of "The Computer Language Shootout Benchmarks" nor the names of + its contributors may be used to endorse or promote products derived + from this software without specific prior written permission. + +THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" +AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE +ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE +LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR +CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF +SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS +INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN +CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) +ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE +POSSIBILITY OF SUCH DAMAGE. +*/ + +/* + * http://shootout.alioth.debian.org/u32q/benchmark.php?test=fasta&lang=gcc&id=4 +*/ +/* The Computer Language Benchmarks Game + * http://shootout.alioth.debian.org/ + * Contributed by Joern Inge Vestgaarden + * Modified by Jorge Peixoto de Morais Neto + */ + +#include +#include +#include +#include + +#define WIDTH 60 +#define MIN(a,b) ((a) <= (b) ? (a) : (b)) +#define NELEMENTS(x) (sizeof (x) / sizeof ((x)[0])) + +typedef struct { + float p; + char c; +} aminoacid_t; + +static inline float myrandom (float max) { + unsigned long const IM = 139968; + unsigned long const IA = 3877; + unsigned long const IC = 29573; + static unsigned long last = 42; + last = (last * IA + IC) % IM; + /*Integer to float conversions are faster if the integer is signed*/ + return max * (long) last / IM; +} + +static inline void accumulate_probabilities (aminoacid_t *genelist, size_t len) { + float cp = 0.0; + size_t i; + for (i = 0; i < len; i++) { + cp += genelist[i].p; + genelist[i].p = cp; + } +} + +/* This function prints the characters of the string s. When it */ +/* reaches the end of the string, it goes back to the beginning */ +/* It stops when the total number of characters printed is count. */ +/* Between each WIDTH consecutive characters it prints a newline */ +/* This function assumes that WIDTH <= strlen (s) + 1 */ +static void repeat_fasta (char const *s, size_t count) { + size_t pos = 0; + size_t len = strlen (s); + char *s2 = malloc (len + WIDTH); + memcpy (s2, s, len); + memcpy (s2 + len, s, WIDTH); + do { + size_t line = MIN(WIDTH, count); + fwrite_unlocked (s2 + pos,1,line,stdout); + putchar_unlocked ('\n'); + pos += line; + if (pos >= len) pos -= len; + count -= line; + } while (count); + free (s2); +} + +/* This function takes a pointer to the first element of an array */ +/* Each element of the array is a struct with a character and */ +/* a float number p between 0 and 1. */ +/* The function generates a random float number r and */ +/* finds the first array element such that p >= r. */ +/* This is a weighted random selection. */ +/* The function then prints the character of the array element. */ +/* This is done count times. */ +/* Between each WIDTH consecutive characters, the function prints a newline */ +static void random_fasta (aminoacid_t const *genelist, size_t count) { + do { + size_t line = MIN(WIDTH, count); + size_t pos = 0; + char buf[WIDTH + 1]; + do { + float r = myrandom (1.0); + size_t i = 0; + while (genelist[i].p < r) + ++i; /* Linear search */ + buf[pos++] = genelist[i].c; + } while (pos < line); + buf[line] = '\n'; + fwrite_unlocked (buf, 1, line + 1, stdout); + count -= line; + } while (count); +} + +int main (int argc, char **argv) { + size_t n; + if (argc > 1) { + char const *arg = argv[1]; + char *tail; + n = strtoul (arg, &tail, 0); + if (tail == arg) + errx (1, "Could not convert \"%s\" to an unsigned long integer", arg); + } else n = 1000; + + static aminoacid_t iub[] = { + { 0.27, 'a' }, + { 0.12, 'c' }, + { 0.12, 'g' }, + { 0.27, 't' }, + { 0.02, 'B' }, + { 0.02, 'D' }, + { 0.02, 'H' }, + { 0.02, 'K' }, + { 0.02, 'M' }, + { 0.02, 'N' }, + { 0.02, 'R' }, + { 0.02, 'S' }, + { 0.02, 'V' }, + { 0.02, 'W' }, + { 0.02, 'Y' }}; + + static aminoacid_t homosapiens[] = { + { 0.3029549426680, 'a' }, + { 0.1979883004921, 'c' }, + { 0.1975473066391, 'g' }, + { 0.3015094502008, 't' }}; + + accumulate_probabilities (iub, NELEMENTS(iub)); + accumulate_probabilities (homosapiens, NELEMENTS(homosapiens)); + + static char const *const alu ="\ +GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG\ +GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA\ +CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT\ +ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA\ +GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG\ +AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC\ +AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"; + + fputs_unlocked (">ONE Homo sapiens alu\n", stdout); + repeat_fasta (alu, 2 * n); + fputs_unlocked (">TWO IUB ambiguity codes\n", stdout); + random_fasta (iub, 3 * n); + fputs_unlocked (">THREE Homo sapiens frequency\n", stdout); + random_fasta (homosapiens, 5 * n); + return 0; +} diff --git a/test/bench/fasta.go b/test/bench/fasta.go new file mode 100644 index 0000000000..ca3d56a355 --- /dev/null +++ b/test/bench/fasta.go @@ -0,0 +1,198 @@ +/* +Redistribution and use in source and binary forms, with or without +modification, are permitted provided that the following conditions are met: + + * Redistributions of source code must retain the above copyright + notice, this list of conditions and the following disclaimer. + + * Redistributions in binary form must reproduce the above copyright + notice, this list of conditions and the following disclaimer in the + documentation and/or other materials provided with the distribution. + + * Neither the name of "The Computer Language Benchmarks Game" nor the + name of "The Computer Language Shootout Benchmarks" nor the names of + its contributors may be used to endorse or promote products derived + from this software without specific prior written permission. + +THIS SOFTWARE IS PROVIDED BY THE COPYRIGHT HOLDERS AND CONTRIBUTORS "AS IS" +AND ANY EXPRESS OR IMPLIED WARRANTIES, INCLUDING, BUT NOT LIMITED TO, THE +IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE +ARE DISCLAIMED. IN NO EVENT SHALL THE COPYRIGHT OWNER OR CONTRIBUTORS BE +LIABLE FOR ANY DIRECT, INDIRECT, INCIDENTAL, SPECIAL, EXEMPLARY, OR +CONSEQUENTIAL DAMAGES (INCLUDING, BUT NOT LIMITED TO, PROCUREMENT OF +SUBSTITUTE GOODS OR SERVICES; LOSS OF USE, DATA, OR PROFITS; OR BUSINESS +INTERRUPTION) HOWEVER CAUSED AND ON ANY THEORY OF LIABILITY, WHETHER IN +CONTRACT, STRICT LIABILITY, OR TORT (INCLUDING NEGLIGENCE OR OTHERWISE) +ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED OF THE +POSSIBILITY OF SUCH DAMAGE. +*/ + +/* The Computer Language Benchmarks Game + * http://shootout.alioth.debian.org/ + * + * contributed by The Go Authors. + * Based on C program by Joern Inge Vestgaarden + * and Jorge Peixoto de Morais Neto. + */ + +package main + +import ( + "bufio"; + "bytes"; + "flag"; + "os"; + "strings"; +) + +var out *bufio.Writer + +var n = flag.Int("n", 1000, "length of result") + +const WIDTH = 60 + +func min(a, b int) int { + if a < b { + return a + } + return b +} + +type AminoAcid struct { + p float; + c byte; +} + +var lastrandom uint32 = 42 + +func myrandom() float { + const ( + IM = 139968; + IA = 3877; + IC = 29573; + ) + lastrandom = (lastrandom * IA + IC) % IM; + // Integer to float conversions are faster if the integer is signed. + return float(lastrandom) / IM; +} + +func AccumulateProbabilities(genelist []AminoAcid) { + cp := 0.0; + for i := 0; i < len(genelist); i++ { + cp += genelist[i].p; + genelist[i].p = cp; + } +} + +/* This function prints the characters of the string s. When it */ +/* reaches the end of the string, it goes back to the beginning */ +/* It stops when the total number of characters printed is count. */ +/* Between each WIDTH consecutive characters it prints a newline */ +/* This function assumes that WIDTH <= strlen (s) + 1 */ +func RepeatFasta(s []byte, count int) { + pos := 0; + s2 := make([]byte, len(s) + WIDTH); + bytes.Copy(s2, s); + bytes.Copy(s2[len(s):len(s2)], s); + for { + line := min(WIDTH, count); + out.Write(s2[pos:pos+line]); + out.WriteByte('\n'); + pos += line; + if pos >= len(s) { + pos -= len(s); + } + count -= line; + if count <= 0 { + break + } + } +} + +/* This function takes a pointer to the first element of an array */ +/* Each element of the array is a struct with a character and */ +/* a float number p between 0 and 1. */ +/* The function generates a random float number r and */ +/* finds the first array element such that p >= r. */ +/* This is a weighted random selection. */ +/* The function then prints the character of the array element. */ +/* This is done count times. */ +/* Between each WIDTH consecutive characters, the function prints a newline */ +func RandomFasta(genelist []AminoAcid, count int) { + buf := make([]byte, WIDTH + 1); + for { + line := min(WIDTH, count); + pos := 0; + for { + r := myrandom(); + var i int; + for i = 0; genelist[i].p < r; i++ { + } + buf[pos] = genelist[i].c; + pos++; + if pos >= line { + break + } + } + buf[line] = '\n'; + out.Write(buf[0:line + 1]); + count -= line; + if count <= 0 { + break + } + } +} + +func main() { + out = bufio.NewWriter(os.Stdout); + defer out.Flush(); + + flag.Parse(); + + iub := []AminoAcid { + AminoAcid{ 0.27, 'a' }, + AminoAcid{ 0.12, 'c' }, + AminoAcid{ 0.12, 'g' }, + AminoAcid{ 0.27, 't' }, + AminoAcid{ 0.02, 'B' }, + AminoAcid{ 0.02, 'D' }, + AminoAcid{ 0.02, 'H' }, + AminoAcid{ 0.02, 'K' }, + AminoAcid{ 0.02, 'M' }, + AminoAcid{ 0.02, 'N' }, + AminoAcid{ 0.02, 'R' }, + AminoAcid{ 0.02, 'S' }, + AminoAcid{ 0.02, 'V' }, + AminoAcid{ 0.02, 'W' }, + AminoAcid{ 0.02, 'Y' } + }; + + homosapiens := []AminoAcid { + AminoAcid{ 0.3029549426680, 'a' }, + AminoAcid{ 0.1979883004921, 'c' }, + AminoAcid{ 0.1975473066391, 'g' }, + AminoAcid{ 0.3015094502008, 't' } + }; + + AccumulateProbabilities(iub); + AccumulateProbabilities(homosapiens); + + alu := strings.Bytes("" + "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" + "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" + "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" + "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" + "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" + "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" + "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA"); + + out.WriteString(">ONE Homo sapiens alu\n"); + RepeatFasta(alu, 2 * *n); + out.Flush(); + out.WriteString(">TWO IUB ambiguity codes\n"); + RandomFasta(iub, 3 * *n); + out.Flush(); + out.WriteString(">THREE Homo sapiens frequency\n"); + RandomFasta(homosapiens, 5 * *n); + out.Flush(); +}